First report of Yellow leaf curl begomowirus on tomato, Uganda

February 26, 2006
From: ProMED-mail<promed@promedmail.org>
Source: American Phytopathological Society, Plant Disease Notes, February 2006 [edited] <http://www.apsnet.org/pd/searchnotes/2006/PD-90-0246A.asp>

Molecular characterization of a begomovirus associated with Tomato leaf curl disease in Uganda

S. L. Shih, S. K. Green, and W. S. Tsai, AVRDC, The World Vegetable Center, Shanhua, Tainan 741, Taiwan, Republic of China; C. Ssekyewa, Faculty of Agriculture, Uganda Martyrs University, P.O. Box 5498, Kampala, Uganda. Plant Dis. 90:246, 2006; published on-line as DOI: 10.1094/PD-90-0246A.
Accepted for publication 5 Nov 2005.

During the summer of 2003, leaf curl symptoms were observed in tomato (_Lycopersicon esculentum_) plantings in the Iganga District of Uganda. Begomoviral infection was suspected.

12 symptomatic samples were collected. Begomoviral DNA was extracted and amplified using polymerase chain reaction (PCR) with the begomovirus-specific degenerate primer pair PAL1v1978/PAR1c715 (4). The expected 1.4-kb PCR products were obtained from 11 of 12 samples. The 1.4-kb PCR product of one of the samples was cloned and sequenced. Based on the sequence of the 1.4-kb DNA product, specific primers were designed to complete the DNA-A sequence. The DNA-A consisted of 2747 nucleotides (GenBank Accession No. DQ127170) and was found to contain 7 predicted open reading frames (ORFs V1, V2, C1, C2, C3, C4, and C5). A BLAST analysis was conducted with geminivirus sequences available in the GenBank database at the National Center for Biotechnology Information (Bethesda, MD), and MegAlign (DNASTAR, Inc, Madison, WI) software was used for
further comparisons. The DNA-A sequence of the virus associated with leaf curl of tomato from Uganda showed less than 79 percent sequence identity with cassava mosaic viruses from Uganda (GenBank/EMBL Accession Nos. AF126800, AF126802, AF126804, AF126806, and Z83257), the only begomoviruses from the country so far in the public domain. Highest sequence identity (83 percent) was with Tomato leaf curl Mayotte virus from Dembeni, Mayotte, Comoros Islands (ToLCYTV-[Dem], EMBL Accession No. AJ865341). Pairwise comparison with ToLCYTV-
[Dem] showed 60, 88, 91, 82, 84, 86, and 80 percent sequence identities in the intergenic region, V2, V1, C1, C2, C3, and C4 ORFs, respectively. Only low sequence identities (ranging from 71 to 82 percent) were obtained with other tomato begomoviruses reported from Africa (GenBank/EMBL Accession Nos. AF261885, AJ865337-AJ865340, AY044137-AY044139, AY502934, AY502936, AY594174, AY736854, and U73498). There was no evidence for the presence of DNA-B or DNA-beta using PCR with the DNA-B specific primer pairs DNABLC1/DNABLV2 and DNABLC2/DNABLV2 (2) and the DNA-beta primer pair Beta01/Beta02 (1), respectively. Detection of possible recombination was by RDP2 software (3) using DNA-A sequences of begomoviruses from Uganda and tomato begomoviruses from Africa. The DNA-A was found to contain a small recombinant fragment from ToLCYTV-[Dem] in the 411 to 969 nucleotide position with 92 percent sequence identity. Based on DNA-A sequence comparisons, the tomato leaf curl virus from Uganda most likely constitutes a distinct new begomovirus.

References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) D. P. Martin et al. Bioinformatics 21:260, 2005. (4) M. R. Rojas et al. Plant Dis.77:340, 1993.

[Map: Iganga, Uganda
<http://www.tageo.com/index-e-ug-v-78-d-m2422363.htm>
- Mod.JAD]

First report of Yellow leaf curl begomovirus in tomato and pepper, Bogor, Indonesia
Date: 3 Mar 2006
From: ProMED-mail<promed@promedmail.org>
Source: American Phytopathological Society, Plant Disease Notes, February 2006
[edited] <http://www.apsnet.org/pd/searchnotes/2006/PD-90-0247B.asp>

Molecular Characterization of Pepper yellow leaf curl virus in Leaf Curl and Yellowing Diseased Tomato and Pepper in Indonesia

W. S. Tsai, Department of Plant Pathology, National Chung Hsing University, 250 Kuo-Kuang Rd., Taichung 402, Taiwan, R.O.C.; S. L. Shih and S. K. Green, AVRDC-The World Vegetable Center, Shanhua, Tainan 741, Taiwan, R.O.C.; A. Rauf and S. H. Hidayat, Department of Plant Pests and Diseases, Faculty of Agriculture, Bogor Agriculture University, Indonesia; and F.-J. Jan, Department of Plant Pathology, National Chung Hsing University, 250 Kuo-Kuang Rd., Taichung 402, Taiwan, R.O.C. Plant Dis. 90:247, 2006; published on-line as DOI: 10.1094/PD-90-0247B. Accepted for publication 14 Nov 2005.

Yellowing and leaf curl symptoms were observed in tomato and pepper fields near Bogor, Java, Indonesia in 2000. Samples were collected from one diseased tomato (_Lycopersicum esculentum_) and three diseased chili pepper (_Capsicum annuum_) plants. Viral DNA was extracted (2) and tested for the presence of geminiviral DNA-A, DNA-B, and associated satellite DNA using polymerase chain reaction (PCR) with previously described primers (1,3,4). The begomovirus DNA-A general primer pair PAL1v1978/PAR1c715 amplified the predicted 1.4-kb DNA
fragment from the tomato and 2 of the chili samples. DNA-B and satellite DNA were not detected using PCR with DNA-B general primer pairs (DNABLC1/DNABLV2 and DNABLC2/DNABLV2) and satellite detection primer pair (Beta01/Beta02). The amplicons from the tomato and from one of the chili samples were cloned and sequenced. On the basis of the 1.4-kb DNA sequences, specific primers were designed to complete the DNA-A sequences. Following sequence assembly, the full-length DNA-A nucleotide sequences were determined as 2744 nt (GenBank Accession No. DQ083765) for the tomato- and 2743 nt (GenBank Accession No. DQ083764) for the chili-infecting begomoviruses. Sequence comparisons and analyses were conducted using the DNAMAN sequence analysis
software (Lynnon Corporation, Quebec, Canada). The DNA-A of both begomoviruses contained 6 open reading frames, including 2 in the virus sense and 4 in the complementary sense, and the geminivirus conserved nanosequence-TAATATTAC in the loop of the hairpin structure of the intergenic region.

Because of their high nucleotide sequence identities of 99 percent, the tomato- and chili-infecting begomovirus are considered the same virus. When compared by using BLAST with available geminiviral sequences in the GenBank database, the DNA-A sequences of the tomato and the chili isolates showed highest nucleotide sequence identity (95 percent) with the partially sequenced Pepper yellow leaf curl Indonesia virus (GenBank Accession No. AB189849) in the 1842 nt to 660 nt region and in the 1841 nt to 659 nt region, respectively.
Comparisons with full-length DNA-A sequences of begomoviruses available in the GenBank database indicated high sequence identities of 76 and 77 percent for the tomato and chili isolates, respectively, with an eggplant isolate of Tomato yellow leaf curl Kanchanaburi virus (GenBank Accession No. AF511530) from Thailand. According to our knowledge, this is the 1st report of full-length DNA-A sequence of the Pepper yellow leaf curl Indonesia virus and its natural occurrence in tomato and pepper in the Bogor area of Indonesia.

References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) R. L. Gilbertson et al. J. Gen. Virol. 72:2843, 1991. (3) S. K. Green et al. Plant Dis. 85:1286, 2001. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

[Map: Bogor, Indonesia
<http://www.tageo.com/index-e-id-v-00-d-m3694719.htm> - Mod.JAD]

First report of Yellow leaf curl begomovirus on tomato, South Carolina, USA
Date: 3 Mar 2006
From: ProMED-mail<promed@promedmail.org>
Source: American Phytopathological Society, Plant Disease Notes, March 2006
[edited] <http://www.apsnet.org/pd/searchnotes/2006/PD-90-0379C.asp>

First Report of Tomato yellow leaf curl virus in South Carolina

K. S. Ling and A. M. Simmons, USDA-ARS, U.S. Vegetable Laboratory, Charleston, SC; R. L. Hassell and A. P. Keinath, Clemson University, Coastal Research and Education Center, Charleston, SC; and J. E. Polston, Department of Plant Pathology, University of Florida, Gainesville. Plant Dis. 90:379, 2006; published on-line as DOI: 10.1094/PD-90-0379C. Accepted for publication 2 Jan 2006.

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family _Geminiviridae_, causes yield losses in tomato (_Lycopersicon esculentum_ Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms
were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, 2 commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves.

Another primer set (KL04-06_TYLCV CP F: 5(prime)
GCCGCCGAATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5(prime) GCCGCCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (_Bemisia tabaci_) adults. Expected PCR products were obtained from 8 different samples, including 3 tomato samples from the greenhouse, 2 tomato plants from commercial fields, 2 plants from retail
stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, 3 PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99 percent nucleotide identity with TYLCV isolates from Florida, the Dominican
Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in 2 separate experiments, 100 percent of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1 percent) of symptomatic plants was observed in the 2 commercial tomato fields. In addition, 2 symptomatic tomato plants obtained from 2 different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of "across-state" distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the 1st report of TYLCV in South Carolina.

Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

[Map: Charleston, South Carolina, USA
<http://www.tageo.com/index-e-us-v-sc-d-1221516.htm>
- Mod.JAD]

--
ProMED-mail
<promed@promedmail.org>

[The crop plant tomato, _Lycopersicon esculentum_, is susceptible to the disease leaf curl, caused by the tomato yellow leaf curl virus (TYLCV) (family: _Geminiviridae_, genus: _Begomovirus_). TYLCV can cause serious loss
when it affects fruit yield severely, and is the main limiting factor in tomato production in many parts of the world. Tomato plants are severely stunted with shoots becoming erect. Leaflets become reduced in size and pucker. Leaves curl upwards, become distorted, and have prominent yellow margins. Flowers wither or appear normal, and the fruits that set either show no symptoms from the viral infection or they may be small, dry and unsaleable
when infections come early in the season. The disease is found around the world where the whitefly vector _Bemisia tabaci_ biotype B is present (see map below and the "see also" section). While it is impractical to completely eradicate a vector-borne viral disease, a combination of production practices may minimize the i!
mpact of the disease. These include using disease-free transplants, roguing the infected plants (early in the season), and managing whitefly populations using various insecticides or reflective mulches.

The investigators in the 3 reports in this update used similar approaches to obtain viral genome sequences, and describe 3 viruses each with close sequence relatedness to different known strains of TYLCV. The Ugandan virus is similar to TYLCV from Dembeni, Mayotte, Comoros Islands but differs from other African strains. The Indonesian virus is similar to pepper yellow leaf curl Indonesia virus and an eggplant isolate of TYLCV from Thailand. The USA - South Carolina virus is similar to TYLCV isolates from Florida, the Dominican Republic, Cuba,
Guadeloupe, and Puerto Rico. The combination of reports points out the genetic diversity of this virus family. The USA find in South Carolina seems to be an example of the introduction of a virus from another state on transplanted seedlings, in this case tomato and pepper.

Map: Worldwide distribution tomato yellow leaf curl virus
<http://www.eppo.org/QUARANTINE/virus/TYLC_virus/TYLCV00_map.htm>

Pictures: <http://creatures.ifas.ufl.edu/veg/leaf/TYLCV.jpg>
<http://www.lsuagcenter.com/Subjects/MasterGardener/LafourcheTerrebonne/Horticulutre/Image23.jpg>
Virus: <http://www.ncbi.nlm.nih.gov/ICTVdb/ICTVdB/29030043.htm>

Links:
<http://www.defra.gov.uk/planth/pestnote/yellow.htm>
<http://www.gaipm.org/vegetable/tomato_yellow_leaf_curl.html>
<http://www.avrdc.org/LC/tomato/tylcv.html>
<http://oisat.org/pests/diseases/viral/leaf_curl__virus.html>
<http://www.ncbi.nlm.nih.gov/ICTVdb/ICTVdB/29030043.htm>
- Mod.JAD]

[see also in the archive:
2005
----
ProMED-Plant Disease Report: July - December 2005 20060201.0331
Tomato chlorosis virus, tomato - Cyprus: 1st report 20051228.3699
Leaf curl disease, tomato - Indonesia (Java) 20051024.3105
Bell pepper leaf curl virus - Pakistan (Lahore) 20051022.3084
Nomenclature error - ToLCV 20050727.2174
Tomato leaf curl virus - Philippines (Mindanao) 20050725.2155
Quarantine pests, new data - EPPO (02): Spain 2004 20050714.2014
Tomato leaf curl New Delhi virus, chili - India 20050712.1984
Tomato leaf curl virus - Bangladesh 20050608.1593
Tomato leaf curl virus, New Delhi strain - India 20050603.1548
Tomato yellow leaf curl, tomato - Reunion (French OD) 20050106.0027
2004
----
Quarantine pests, new data - EPPO (05) 20041106.3007
Quarantine pests, new data - EPPO 20040831.2423
Tomato leaf curl virus, new species - France (Mayotte) 20040528.1444
Tomato yellow leaf curl virus, squash - Cuba 20040517.1323
Tomato leaf curl virus, chilli pepper - Pakistan 20040509.1255
Tomato yellow leaf curl, tomato - Reunion (French OD) 20040204.0411
2003
----
Tomato yellow leaf curl virus, tomato - Guadeloupe 20031231.3174
Tomato severe leaf curl disease - Mexico 20031030.2707
Tomato leaf curl virus, potato - India: first report 20031001.2470
Plant pests, new data, EPPO (04) 20030915.2336
Tomato yellow leaf curl, new strain, tomato - Spain 20030722.1788
Tomato yellow leaf curl, tomato - Italy 20030615.1478
Tomato leaf curl, tomato - Australia 20030608.1413
Tomato and cucurbit viruses - France 20030503.1107
Begomovirus species, tomato, eggplant - Thailand 20030325.0743
Leaf curl, tomato - India (Uttar Pradesh) 20030222.0455
Begomoviruses, chili pepper, tomato - Asia 20030221.0450
2002
----
Tomato yellow leaf curl, new species - Madagascar 20021122.5870
Tomato yellow leaf curl, tomato - France 20021114.5793
Quarantinable plant pests, tomato - Turkey, Spain 20020803.4931
Tomato yellow leaf curl virus, bean - Cuba 20020707.4682
EPPO Alert List: new listings (04) 20020524.4307
Tomato yellow leaf curl begomovirus, pepper - Cuba 20020127.3412
Quarantine plant pathogens, food crops - Spain 20020107.3186
Tomato begomoviruses, recombination - Spain 20020101.3146
2001
----
EPPO Alert List: New Listings (02) 20011201.2923
EPPO alert list, deletions 20011124.2883
Tomato viruses - Tunisia 20010926.2349
Tomato leaf curl begomovirus, tomato - Greece 20010707.1307
Tomato yellow leaf curl virus species 20010622.1187
Tomato yellow leaf curl begomovirus - Bahamas 20010612.1144
New begomoviruses, tomato 20010530.1051
Begomoviruses, tomato - Nicaragua 20010514.0937
Tomato leaf curl begomovirus, tomato disease - India (02) 20010402.0663
Tomato leaf curl begomovirus, tomato disease - India 20010331.0649
Tomato yellow leaf curl begomovirus - USA (Louisiana) 20010327.0623
2001
----
Tomato dwarf leaf curl virus - Jamaica 20000503.0669
Tomato yellow mosaic begomovirus - Venezuela 20000430.0661
Tomato golden mosaic begomovirus - Brazil, Costa Rica 20000418.0561
Sinaloa tomato leaf curl begomovirus - Mex., Costa Rica 20000412.0520
Solanaceous crop begomoviruses: additions to EPPO alert 20000402.0487
Tomato yellow leaf curl begomovirus - USA (Florida) 20000229.0278
Tomato yellow leaf curl begomovirus - Spain 20000227.0266
Tomato yellow leaf curl begomovirus - Mexico 20000226.0262
Tomato yellow leaf curl begomovirus - Morocco 20000222.0239
Tomato & pepper begomoviruses - Mexico (Sonora) 20000126.0131
Plant pests, new data, EPPO 20000122.0112
1999
----
EPPO alert list, part 5/5: August 1999 19991101.1966
EPPO alert list, part 1/5: August 1999 19991027.1947
EPPO alert list: August 1999 19990925.1704
Tomato yellow leaf curl - USA (Florida, Georgia) 19990702.1114
1998
----
Tomato yellow leaf curl begomovirus - Algeria 19981121.2244
Tomato yellow leaf curl begomovirus: spreading 19980528.1026
Tomato yellow leaf curl virus - USA (Florida) 19980515.0945
1997
----
Tomato yellow leaf curl virus and citrus canker - USA (Florida): 19970907.1932
Tomato yellow leaf curl virus and citrus canker - USA (Florida) 19970903.1869
1995
----
Plant Geminiviruses - Burkina Faso 19950927.0896]