January 5, 2005
Source: British Soc. Plant Pathol., New Disease Reports, Vol. 10 [edited]

The presence of both recombinant and non-recombinant strains of Tomato yellow leaf curl virus on tomato in Reunion Island
H. Delatte, CIRAD, UMR PVBMT CIRAD-Universite de La Reunion, Pole de Protection des Plantes, Ligne Paradis, 97410 Saint-Pierre, La Reunion, France; H. Holota (as for Delatte); F. Naze (as for Delatte); M. , Peterschmitt, CIRAD, UMR BGPI, TA 41/K, 34398 Montpellier Cedex 5, France; B. Reynaud (as for Delatte); and J.M. Lett (as
for Delatte). Accepted for publication 22 Nov 2004

Tomato yellow leaf curl virus (TYLCV) was first detected in Reunion in 1997, based on symptoms and partial sequence data between the conserved nonanucleotide and the 1st 5' quarter of the capsid protein (CP) gene
(Peterschmitt et al., 1999). A 516-bp portion of the C4 gene of the same isolate of TYLCV from Reunion was subsequently sequenced (Acc. No. AJ842312) showing that it belonged to the mild strain (TYLCV-Mld[RE]) and
the so-called non-recombinant group (Navas-Castillo et al., 2000).

In April 2004, strong symptoms of stunting, yellowing and leaf curling, resembling the symptoms of TYLCV disease, were observed on tomato plants in Saint Gilles, in the North West region of Reunion.

22 symptomatic tomato leaf samples were collected and tested for the presence of begomoviruses using a polymerase chain reaction (PCR) assay with 2 sets of primers designed to amplify 2 regions of the A component of TYLCV: primers V2790 and C837 amplify a 800-bp fragment spanning the intergenic conserved region (IR) nonanucleotide sequence and 2 thirds of the CP gene, while primers TY1944 (TTGTTTTGCCTGTTCTGCTA) and TY2460 (CATCTCCATGTGCTTATCCA) amplify a 516-bp portion of the C4 gene. The latter region was chosen to differentiate the Israeli strain (syn. TYLCV [Israel]; Acc. No. X15656) from the mild strain (TYLCV-Mld; Acc. No. X76319).

All of the leaf samples produced PCR products of the expected size with both sets of primers. For 3 samples a 483-bp fragment of the C4 gene was sequenced using the primer set TY1944/TY2460 (Acc. Nos AJ842309, AJ842310 and AJ842311) and a 685-bp fragment of IR/CP region was sequenced using the primer set V2790 (ATCCGTATAATATTACCGGATGG ) and C837 GCAAATCATTCTTCACTGTTGC) (Acc. Nos AJ842306, AJ842307 and AJ842308).

The sequences were aligned with those of known TYLCV strains using DNAMAN (Lynnon Biosoft, Quebec). The 685-bp fragment showed 98-99 percent nucleotide identity with TYLCV, TYLCV-Mld and -Mld[RE]. However, the 483-bp fragment showed a 98 percent nucleotide identity with TYLCV, but only 77 percent nucleotide identity with TYLCV-Mld and TYLCV-Mld[RE].

This is the 1st report of the presence of the Israeli strain, which belongs to the so-called recombinant group of TYLCV, from Reunion.

References

Peterschmitt M, Granier M, Mekdoud R, Dalmon A, Gambin O, Vayssieres JF, Reynaud B, 1999. First report of tomato yellow leaf curl virus in Reunion island. Plant Disease 83, 303.

Navas-Castillo J, Sanchez-Campos S, Noris E, LouroD, Acotto GP, Moriones E, 2000. Natural recombination between Tomato yellow leaf curl virus-Is and Tomato leaf curl virus. Journal of General Virology 81, 2797-2801.

--
ProMED-mail
<promed@promedmail.org> 

[TYLC is one of the most devastating viral diseases of cultivated tomato in tropical and subtropical regions. It is spread efficiently by an insect vector (_Bemisia tabaci_ [Bt]), and the difficulty of its management is
compounded by the existence of distinct biotypes, of which the 'B' and 'Q' biotypes are of key interest in southern Europe. The disease is difficult to identify because of great variation in symptom expression. Infected
seedling transplants may serve as the route for long-distance spread of the virus and, when introduced into areas of high Bt populations, results in extensive and rapid spread of the virus. High levels of resistance to TYLCV
were detected in 7 of 9 accessions of _Lycopersicon peruvianum_ and in all 5 accessions of _L. chilense_ tested. In contrast, plants of 7 accessions of _L. hirsutum_ and 3 of 4 accessions of _L. pimpinellifolium_ were highly
susceptible. Plants of accession CIAS 27 (_L. pimpinellifolium_) showed moderate resistance to TYLCV.

Note: The link to the original of this piece contains all of the text and graphics of the edited version and is located at the top of the list of links.

Links:
<http://www.bspp.org.uk/ndr/jan2005/2004-74.asp>
<http://www.agri.gov.il/Depts/Reports/VirusResTomato.html>
<http://www.app-online.pl/abs.php?yy=22&vv=20003&id=460>
<http://www.app-online.pl/abs.php?yy=22&vv=20003&id=461#38>
<http://www3.interscience.wiley.com/cgi-bin/abstract/106566228/ABSTRACT>
<http://departments.agri.huji.ac.il/plantscience/staff-eng/czosnek-files/czosnek-research.html>
<http://pest.cabweb.org/PDF/BER/BER88-3/219.pdf>
- Mod.DH]