October 19, 2004
From: ProMED-mail<promed@promedmail.org>
Source: American Phytopathological Society, Plant Disease Notes [edited]

First report of tomato chlorosis virus in Israel
L. Segev, Department of Virology, Volcani, P.O. Box 6, Bet Dagan 50250, Israel; W. M. Wintermantel, USDA-ARS, 1636 E. Alisal St., Salinas, CA 93905; J. E. Polston, Department of Plant Pathology, University of Florida, Gainesville 32607; and M. Lapidot, Department of Virology, Volcani, P.O. Box 6, Bet Dagan 50250, Israel. Plant Dis. 88:1160, 2004; published on-line as D-2004-0801-01N, 2004. Accepted for publication 7 Jul 2004.

During December 2003, symptoms were observed in greenhouse tomato plants in Bet Dagan, Israel that resembled those of Tomato chlorosis virus (ToCV), a crinivirus common in the southeastern United States and southern Europe (2,3). Middle-aged leaves showed interveinal chlorosis, while more mature leaves showed more intense interveinal chlorosis with some interveinal bronzing. Symptoms were associated with the presence of _Bemisia tabaci_, an efficient vector of ToCV.

Total nucleic acids were extracted (1) from middle-aged and mature leaves from 2 symptomatic plants, as well as from healthy tomato, _Physalis wrightii_ infected with ToCV, and _Nicotiana benthamiana_ infected with Tomato infectious chlorosis virus (TICV), another crinivirus that produces identical symptoms on tomato.

Extracts were tested using hybridization with probes specific to the coat protein (CP) gene of ToCV and the HSP70h gene of TICV. Hybridization results identified the presence of ToCV in all samples from symptomatic
tomato plants and ToCV-infected _P. wrightii_, but not in those from healthy tomato or TICV-infected _Nicotiana benthamiana. TICV was detected only in TICV-infected _Nicotiana benthamiana.

Extracts were also subjected to reverse transcription-polymerase chain reaction using primers specific to the CP gene of ToCV (GenBank Accession No. AY444872; Forward primer: 5(prime) ATGGAGAACAGTGCCGTTGC 3(prime);
Reverse Primer: 5(prime) TTAGCAACCAGTTATCGATGC 3(prime).

All samples from symptomatic tomato and ToCV-infected _P. wrightii_ produced amplicons of the expected size, but no amplicons were produced from extracts of healthy tomato. Laboratory results and observed symptoms confirm the presence of ToCV in symptomatic tomatoes.

To our knowledge, this is the 1st report of ToCV in Israel.

References:
(1) S. Dellaporta et al. Plant Mol. Biol. Rep. 1:19, 1983.
(2) J. Navas-Castillo et al. Plant Dis. 84:835, 2000.
(3) G. C. Wisler et al. Phytopathology 88:402, 1998.

[ToCV is transmitted by several insect vectors, including the greenhouse whitefly, _Trialeurodes vaporariorum_, the banded-wing whitefly (_T. abutilonea_), _Bemisia tabaci_ (biotype A), and _B. argentifolii_ (biotype B). The virus is a nasty pest, especially in glasshouse operations. Although it can cause severe crop losses in fresh market and glasshouse-produced tomatoes, damage is generally minor. It also infects several other food crops monitored by ProMED-Plant such as lettuce (_Lactuca sativa_) and potato (_Solanum tuberosum_). The fact that ToCV and TICV induce identical symptoms in tomato requires careful diagnosis to distinguish between the 2 viruses. Disease management depends upon use of virus-free transplants, control of susceptible weed species, roguing of infected plants, and control of insects by chemical insecticides.

Links:
<http://www.apsnet.org/online/feature/whitefly/>
<http://www.eppo.org/QUARANTINE/Alert_List/viruses/tmcxxx.htm>
- Mod.DH]