|
A
ProMED-mail post
ProMED-mail is a program of the
International Society for Infectious Diseases
October 19, 2004
From: ProMED-mail<promed@promedmail.org>
Source: American Phytopathological Society, Plant Disease Notes
[edited]
First report of tomato chlorosis virus in Israel
L. Segev, Department of Virology, Volcani, P.O. Box 6, Bet
Dagan 50250, Israel; W. M. Wintermantel, USDA-ARS, 1636 E.
Alisal St., Salinas, CA 93905; J. E. Polston, Department of
Plant Pathology, University of Florida, Gainesville 32607; and
M. Lapidot, Department of Virology, Volcani, P.O. Box 6, Bet
Dagan 50250, Israel. Plant Dis. 88:1160, 2004; published on-line
as D-2004-0801-01N, 2004. Accepted for publication 7 Jul 2004.
During December 2003, symptoms were observed in greenhouse
tomato plants in Bet Dagan, Israel that resembled those of
Tomato chlorosis virus (ToCV), a crinivirus common in the
southeastern United States and southern Europe (2,3).
Middle-aged leaves showed interveinal chlorosis, while more
mature leaves showed more intense interveinal chlorosis with
some interveinal bronzing. Symptoms were associated with the
presence of _Bemisia tabaci_, an efficient vector of ToCV.
Total nucleic acids were extracted (1) from middle-aged and
mature leaves from 2 symptomatic plants, as well as from healthy
tomato, _Physalis wrightii_ infected with ToCV, and _Nicotiana
benthamiana_ infected with Tomato infectious chlorosis virus
(TICV), another crinivirus that produces identical symptoms on
tomato.
Extracts were tested using hybridization with probes specific to
the coat protein (CP) gene of ToCV and the HSP70h gene of TICV.
Hybridization results identified the presence of ToCV in all
samples from symptomatic
tomato plants and ToCV-infected _P. wrightii_, but not in those
from healthy tomato or TICV-infected _Nicotiana benthamiana.
TICV was detected only in TICV-infected _Nicotiana benthamiana.
Extracts were also subjected to reverse transcription-polymerase
chain reaction using primers specific to the CP gene of ToCV
(GenBank Accession No. AY444872; Forward primer: 5(prime)
ATGGAGAACAGTGCCGTTGC 3(prime);
Reverse Primer: 5(prime) TTAGCAACCAGTTATCGATGC 3(prime).
All samples from symptomatic tomato and ToCV-infected _P.
wrightii_ produced amplicons of the expected size, but no
amplicons were produced from extracts of healthy tomato.
Laboratory results and observed symptoms confirm the presence of
ToCV in symptomatic tomatoes.
To our knowledge, this is the 1st report of ToCV in Israel.
References:
(1) S. Dellaporta et al. Plant Mol. Biol. Rep. 1:19, 1983.
(2) J. Navas-Castillo et al. Plant Dis. 84:835, 2000.
(3) G. C. Wisler et al. Phytopathology 88:402, 1998.
[ToCV is transmitted by several insect vectors, including the
greenhouse whitefly, _Trialeurodes vaporariorum_, the
banded-wing whitefly (_T. abutilonea_), _Bemisia tabaci_
(biotype A), and _B. argentifolii_ (biotype B). The virus is a
nasty pest, especially in glasshouse operations. Although it can
cause severe crop losses in fresh market and glasshouse-produced
tomatoes, damage is generally minor. It also infects several
other food crops monitored by ProMED-Plant such as lettuce
(_Lactuca sativa_) and potato (_Solanum tuberosum_). The fact
that ToCV and TICV induce identical symptoms in tomato requires
careful diagnosis to distinguish between the 2 viruses. Disease
management depends upon use of virus-free transplants, control
of susceptible weed species, roguing of infected plants, and
control of insects by chemical insecticides.
Links:
<http://www.apsnet.org/online/feature/whitefly/>
<http://www.eppo.org/QUARANTINE/Alert_List/viruses/tmcxxx.htm>
- Mod.DH]
|