January 15, 2003
From: British Society of Plant Pathology, New Disease Reports, vol 8 [edited]

The 1st report of potato spindle tuber viroid (PSTVd) in commercial tomatoes in the UK
RA Mumford <r.mumford@csl.gov.uk>, B Jarvis, A Skelton (Central Science Laboratory, Sand Hutton, York, YO41 1LZ, UK).
Accepted for publication 15 Dec 2003.

In July 2003, samples were received from a glasshouse tomato crop in south east England. The samples were sent following the appearance of virus-like symptoms in a few plants of variety 'Passion'. Affected plants showed a range of symptoms including yellowing, leaf curling, and epinasty, in addition to whole plant stunting and bunching of stems in the crown ('bunchy top').

Given the symptoms, the samples were tested for potato spindle tuber pospiviroid (PSTVd) using a TaqMan reverse transcriptase-polymerase chain reaction (RT-PCR) assay (Mumford et al, 2000) and all samples tested positive. Moreover, samples collected earlier in the crop tested positive in enzyme linked immunosorent assay (ELISA) for Pepino mosaic potexvirus (PepMV).

To confirm the TaqMan results, certain samples were tested further by RT-PCR using primers known to detect a range of different pospiviroids (Mumford et al, 2000; Mumford, 2002) and a product of the predicted size (264 bases) was obtained. Using RT-PCR with a 2nd primer set (PSTVd 133F CCCACCGCGCCTTTTGCCAG and PSTVd 134R GAGTGCCTCGCGGCCGAG), a full-length product of 358 bases was obtained. This was sequenced (Acc. No. AJ583449) and shown to share very high sequence similarity (over 89 per cent) with all published PSTVd sequences. The closest homology (99.4 per cent similarity) was with an isolate recently identified in tomato from New Zealand (Acc. No. AF369530).

Following confirmation of PSTVd infection, the crop was extensively screened both by visual assessment and laboratory testing. About 80 infected plants tested positive for PSTVd presence, within an area of the crop containing around 69 000 plants. The origin of the infection is unknown, but the crop has now been removed and measures were taken that eradicated the infection.

While PSTVd has previously been found under controlled conditions in a potato germplasm collection in the UK (Cammack & Harris, 1973), this is the 1st report of an outbreak in a commercial crop.

References
Cammack RH, Harris PS. Potato spindle tuber in the Commonwealth Potato Collection. EPPO Bulletin 1973; 3: 117-8.
Mumford RA. Protocols for the diagnosis of Quarantine pests: Chrysanthemum stunt viroid. EPPO Bulletin 2002; 32: 245-53.
Mumford RA, Walsh K, Boonham N. A comparison of molecular methods for the routine detection of viroids. EPPO Bulletin 2000; 30: 431-6.

[PSTVd is a nasty pathogen. Disease management depends upon adherence to a strict phytosanitary regimen to prevent contamination and subsequent spread of the viroid. Benches, tools, storage bins, and sacks can be disinfected with 3 per cent hypochlorite.

I had heard comments about PSTVd in potato while I was on leave to the Scottish Horticultural Research Institute, Dundee in 1978, and I am glad to see the reference by Cammack and Harris.

A comment I had made regarding the 1st instance of PSTVd was in error; the 1st instance of PSTVd infection was in the Commonwealth Potato Collection, reported in 1973. The current infection is the second occurrence of the
disease in the UK, this time in a commercial crop. - Mod.DH]