News section
Potato deforming mosaic disease is caused by an isolate of Tomato yellow vein streak virus

A ProMED-mail post
ProMED-mail is a program of the International Society for Infectious Diseases

September 29, 2005
From: British Society for Plant Pathology, New Disease Reports, Vol. 12 [edited] <http://www.bspp.org.uk/ndr/jan2006/2005-70.asp>

Potato deforming mosaic disease is caused by an isolate of Tomato yellow vein streak virus
S.G. Ribeiro, Embrapa Recursos Geneticos e Biotecnologia, Pq. Estacao Biologica, Brasilia, DF, Brazil; A.K. Inoue-Nagata, Embrapa Hortalicas, C. Postal: 0218, 70359-970, Brasilia, DF, Brazil; J. Daniels, Embrapa Clima Temperado, Rodovia BR 392, km 78, Pelotas, RS, Brazil; and A.C. de Avila (Inoue-Nagata) Accepted for publication 8 Sep 2005.

The disease known as potato deforming mosaic was first reported in the 1980's in Southern Brazil (Daniels & Castro, 1985). Symptoms of mosaic with leaf distortion were seen in infected potato plants and a virus was
suggested as the causal pathogen. In this study, we have characterised the causal agent of this disease by transmission experiments and molecular analysis of the viral genome.

The original virus isolate was collected from a potato plant in 1983 in the State of Rio Grande do Sul and maintained through vegetative propagation in the greenhouse. The virus was easily transmitted from potato by the whitefly _Bemisia tabaci_ biotype B causing mottling, chlorotic spots and leaf distortion on tomato, vein-banding and mosaic on _Nicotiana benthamiana_ and vein-clearing on _Nicandra physaloides_. These properties
are consistent with the disease agent being a geminivirus.

PCR amplification using primers CP2 (5'cccctgcagaacttccaagtctggacg3') and PAL1v1978 (Rojas et al., 1993) produced a DNA A derived fragment of 1.8 Kb encoding the entire coat protein gene, common region and part of the AC1 gene. Sequence comparison showed highest identity (97.3 percent) to Tomato yellow vein streak virus (ToYVSV-U79998), a virus previously described in tomatoes in Brazil (Faria et al., 1997). The presence of a B component was confirmed by PCR with primers B1200F 5'CCCCTGCAGTAYTAYTGYTGGATGTC3') and B1900R (5'cccctgcagrtgyaacatwgatctcc3'); with amplification of a fragment of approximately 800nt comprising the 3' end of the BV1 gene, the small intergenic region and the 5' half of the BC1 gene.

Our results indicate that the potato deforming mosaic and tomato yellow vein streak diseases are caused by the same geminivirus, belonging to the genus _Begomovirus_. Potato deforming mosaic disease was described more
than 20 years ago but was of little economical relevance (Daniels & Castro, 1985). Since then this virus, now named Tomato yellow vein streak virus (ToYVSV), has re-emerged and is currently the major begomovirus affecting tomatoes and potatoes in the state of Sao Paulo (Souza-Dias et al., 2003).

This is the 1st record of natural infection of ToYVSV in potato.

Acknowledgement

We wish to thank Dr Marcel Prins for his comments.

References

Daniels, J, Castro LAS, 1985. Ocorrencia do virus do mosaico deformante da batata no Rio Grande do Sul. Fitopatologia Brasileira 10, 306.

Faria JC, Souza-Dias JAC, Slack S, Maxwell DP, 1997. A new geminivirus associated with tomato in the State of Sao Paulo, Brazil. Plant Disease 81, 423.

Rojas MR, Gilbertson RL, Russell DR, Maxwell DP, 1993. Use of degenerate primers in the polymerase chain reaction to detect whitefly-transmitted geminiviruses. Plant Disease 77, 340-347.

Souza-Dias JAC, Sawasaki HE, Santini A, 2003. Plantio sucessivo de batata e tomate na regiao de Sumare, SP favorece a presenca do Tomato yellow vein streak geminivirus (ToYVSV) e da mosca branca vetora. Fitopatologia
Brasileira 28, 372.

--
ProMED-mail
<promed@promedmail.org>

[It is interesting that it took over 20 years to recognize that ToYVSV and Potato yellow deforming virus were one and the same virus. In potato, the apical leaves showed yellow or green mottle which developed into leaf
distortion with yellow blotches (apparently no natural infection have been found on potato). About 20 percent of young tomato plants showed virus symptoms. Tomato is an important crop in the EPPO region, and both indoor
and outdoor and the virus vector is present in many parts of the EPPO region. The disease appears so far, limited in Brazil but data is lacking about its extent and severity. It is not known whether potato can be naturally infected

Links:
<http://gemini.biosci.arizona.edu/viruses/toyvsv/>
<http://www.scielo.br/scielo.php?pid=S0100-41582003000200007&script=sci_abstract&tlng=en>
- Mod.DH]

[see also in the
archive:
2000
Tomato yellow vein streak begomovirus 20000502.0666]

ISID/ProMED-mail post news item

Other releases from this source

13,658

Back to main news page

The news release or news item on this page is copyright © 2005 by the organization where it originated.
The content of the SeedQuest website is copyright © 1992-2005 by
SeedQuest - All rights reserved
Fair Use Notice